shc002
Shc002 - Sigma-Aldrich
shc002
website shc002 shrna: Sigma MISSION SHC002 sequence: CAACAAGATGAAGAGCACCAA Treatment protocol, Cells were plated 24 hours before transduction with shc002 Order Online Forever52 4 Color Contour & Highlighter SHC002 and Enjoy Free Delivery from 90 AED, Cash on Delivery, Cold Storage, Pay later with Installments
shc002 SHC002; UPC: MPN: SHC002; Availability: Drop ships from the manufacturer to medical facilities only Shipping: Calculated at Checkout SHC002 Sigma-Aldrich Levels of SHC002 and SHC016 cassettes were similar at 2 days after transduc- tion in both cell lines However, in contrast to the empty vector and pLKO-SHC002 SHC002 - MISSION® Non-Mammalian shRNA Control Plasmid DNA Description Application To see more application data, protocols
Unable to load receipt Availability
